View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_30 (Length: 208)
Name: NF10608_low_30
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 33940463 - 33940640
Alignment:
| Q |
20 |
tggtagtctgaccgaattatggtttatgatagaatgttatagcgtggtttaatccatgtagtcagtcttatttaatggaatatggtttggtttttgttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
33940463 |
tggtagtctgaccgaattatggtttaggatagaatgttatagcatggtttaatccatgtagtcagtcttacttaatggaatatggtttgatttttgttgt |
33940562 |
T |
 |
| Q |
120 |
tgcagtttcataattacagtttagatagtaaaaaattgtgaagata-ttgatatgttgagtgtttgtttgaacctatg |
196 |
Q |
| |
|
||| ||||||||||||| ||| |||||||||||||||||||| | | || |||||||||||||||||||||||||||| |
|
|
| T |
33940563 |
tgcggtttcataattactgttcagatagtaaaaaattgtgaacacatttaatatgttgagtgtttgtttgaacctatg |
33940640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University