View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_5 (Length: 361)
Name: NF10608_low_5
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 343
Target Start/End: Original strand, 42444512 - 42444839
Alignment:
| Q |
16 |
ctattcactcaatcagaagaagatttagaaagctggcatcattcattcatgccaactacggttatgagctctgatgaacaaccgcgaatgatttattcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444512 |
ctattcactcaatcagaagaagatttagaaagctggcatcattcattcatgccaactacggttatgagctctgatgaacaaccgcgaatgatttattcat |
42444611 |
T |
 |
| Q |
116 |
acagaaatgtgttgagtggttttgccgcaagactaactcaagaagagttgagagctgttgaacagaagaatggttttgtttcagctcatcccgaaaggac |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444612 |
accgaaatgtgttgagtggttttgccgcaagactaactcaagaagagttgagagctgttcaacagaagaatggttttgtttcagctcatcccgaaaggac |
42444711 |
T |
 |
| Q |
216 |
actacgtcgtcaaaccacacataccccagatttcttggggttgcagcaaaatatcggattttggaaggaatcaaattttggaaagggaattattattggt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444712 |
actacgtcgtcaaaccacacataccccagatttcttggggttgcagcaaaatatcggatcttggaaggaatcaaattttggaaagggaattattattggt |
42444811 |
T |
 |
| Q |
316 |
gttctagattcaggaatcacacctgatg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42444812 |
gttctagattcaggaatcacacctgatg |
42444839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University