View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10610_low_6 (Length: 241)
Name: NF10610_low_6
Description: NF10610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10610_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 54726189 - 54726411
Alignment:
| Q |
1 |
caccagtgaagctgtcagatagcaaggttacaagtcagtagagataaaagtggcatatagtcatatactatgacagcatcatattgattgatatatagtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54726189 |
caccagtgaagctgtcagatagcaaggttacaagtcagtagagataaaagtggcatatagtcatatactatgagagcatcatattgattgatatatagtc |
54726288 |
T |
|
| Q |
101 |
accttatacagttcactcctggatgcattgtaaggaagtcaccaatttctgagcctttgccagtaacacagctgattagacctttgggaaaaccagccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54726289 |
accttatacagttcactcctggatgcattgtaaggaagtcaccaatttctgagcctttgccagtaacacagctgattagacctttgggaaaaccagccaa |
54726388 |
T |
|
| Q |
201 |
gtgaaagcaataaaccatgtgaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
54726389 |
gtgaaagcaataaaccatgtgaa |
54726411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 101 - 211
Target Start/End: Complemental strand, 3007975 - 3007865
Alignment:
| Q |
101 |
accttatacagttcactcctggatgcattgtaaggaagtcaccaatttctgagcctttgccagtaacacagctgattagacctttgggaaaaccagccaa |
200 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||| || || || || ||||| || || |||||||| || ||||||||||| || |||||||| |
|
|
| T |
3007975 |
accttatgcagttcacccctggatgcattgtaagaaagtcgccgatctcagaaccttttcctgtcacacagctaataagacctttggggaagccagccaa |
3007876 |
T |
|
| Q |
201 |
gtgaaagcaat |
211 |
Q |
| |
|
|||||||||| |
|
|
| T |
3007875 |
atgaaagcaat |
3007865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University