View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10610_low_8 (Length: 227)
Name: NF10610_low_8
Description: NF10610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10610_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 54725917 - 54726143
Alignment:
| Q |
1 |
ttgcaatttaaatacgttcatggattatagtggcaccgattatatttatttatgaagtaaatgcatgaaaagacaaaccctgctccctcctttgcaccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54725917 |
ttgcaatttaaatacgttcatggattatagtggcaccggttatatttatttatgaagtaaatgcatgaaaagacaaaccctgctccctcctttgcaccag |
54726016 |
T |
|
| Q |
101 |
aagtgctaattgagacatgtcattcacctgtatgaaaaacctccttttataatgtttgcagcaaccaaatcaaggtcagcatcttcaagtacaatgcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54726017 |
aagtgctaattgagacatgtcattcacctgtatgaaaaacctccttttataatgtttgcagcaaccaaatcaaggtcagcatcttcaagtacaatgcaag |
54726116 |
T |
|
| Q |
201 |
catcttttcctcccaattccatttgta |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
54726117 |
catcttttcctcccaattccatttgta |
54726143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 126 - 210
Target Start/End: Complemental strand, 3008634 - 3008550
Alignment:
| Q |
126 |
acctgtatgaaaaacctccttttataatgtttgcagcaaccaaatcaaggtcagcatcttcaagtacaatgcaagcatcttttcc |
210 |
Q |
| |
|
|||||||||| || |||||||| | |||||| ||||| |||||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3008634 |
acctgtatgagaaccctcctttcacaatgttagcagctaccaaatccaagtcagcatcttcaagaacaatgcaagcatcttttcc |
3008550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University