View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10611_high_20 (Length: 248)
Name: NF10611_high_20
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10611_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 129 - 219
Target Start/End: Original strand, 41110743 - 41110833
Alignment:
| Q |
129 |
ggttggtgtcttttggattgaaacaagatgaaggtgacggtcagtagtagtcattcaataatccaacgacgtcgttttcacttattttcca |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41110743 |
ggttgatgtcttttggattgaaacaagatgaagctgacggtcagtagtagtcattcaataatccaacgacgtcgttttcgcttattttcca |
41110833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 41110619 - 41110669
Alignment:
| Q |
5 |
gagagatgaaggaagaagcgtagtaaccatttttgttatcttgaaaatggg |
55 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41110619 |
gagagaagaaggaagaagcgtagtaaccatttttgttatcttgaaaatggg |
41110669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University