View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10611_low_13 (Length: 333)
Name: NF10611_low_13
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10611_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 32112932 - 32112708
Alignment:
| Q |
19 |
cgtttctccgttaaaaccctagcatcgtttctcctcttcatcacactacgttcaggtgtgtatatcatccagttttcaatcttcaggtgtgtagaaacgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
32112932 |
cgtttctccgttaaaaccctagcatcgtttctcctcttcatcacactacgttcaggtgtgtgtatcacccagttttcaatattcaggtgtgtagaaacgt |
32112833 |
T |
|
| Q |
119 |
tttctaaactcatctgtatattttactttgcactctacgttttctaaacaaaagcatataactagggttttttattttggtagaaaaagcatataactag |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
32112832 |
tttctaaactcatctgtaaattttactttgcactctacgttttctaaacaaaagcatgtaactagggttttttattttggta-aaaaggcatataactag |
32112734 |
T |
|
| Q |
219 |
ggttgattcttggaagtaccacccag |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32112733 |
ggttgattcttggaagtaccacccag |
32112708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 32120487 - 32120428
Alignment:
| Q |
97 |
atcttcaggtgtgtagaaacgttttctaaactcatctgtatattttactttgcactctac |
156 |
Q |
| |
|
|||||| | ||||| | |||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
32120487 |
atcttcggttgtgtggtaacgttttctaaactcatcttaatatattactttgcactctac |
32120428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University