View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10611_low_17 (Length: 311)
Name: NF10611_low_17
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10611_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 42127151 - 42126850
Alignment:
| Q |
1 |
tctcagagaaccttctgctgaagtcacaacctcaccttttgagcaatccatcctatgctccagaagctgaaactgagtctactgaatttattgtggatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42127151 |
tctcagagaaccttctgctgaagtcacaacctcaccttttgagcaatccatcctatgctccagaagctgaaactgagtctactgaatttattgtggatgt |
42127052 |
T |
 |
| Q |
101 |
gtccaagtcacaccagtggagtatacatttacttcaactcttggcacttgttttcatttctatcctgttggtttctcctgcttatctttccatcactact |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42127051 |
gtccaagtctcaccagtggagtatacatttacttcaactcttggcacttgttttcatttctatccttgtggtttctcctgcttatctttccatcactact |
42126952 |
T |
 |
| Q |
201 |
ttccaaatactcatcgcaagtttcggtaaatcagcatatagaattcctttgtcaaactatatattttcacttgccttggcaccactttcttggatccttt |
300 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42126951 |
ttccaaatattcatcgcaagtttcggtaaatcagcatatggaattcctttgtcaaactatatattttcacttgccttggcaccactttcttggatccttt |
42126852 |
T |
 |
| Q |
301 |
gc |
302 |
Q |
| |
|
|| |
|
|
| T |
42126851 |
gc |
42126850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University