View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10611_low_30 (Length: 246)
Name: NF10611_low_30
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10611_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 46326099 - 46326312
Alignment:
| Q |
16 |
atctaaacatgatccttatgagatggttgtgcttttcaatacgtctgttataacttcgtttcctagttgaattagaggacccgttttggtgtgattatcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46326099 |
atctaaacatgatccttatgagatggttgtgcttttcaatacgtctgttataacttcgtttcctagttgaattagaggacccattttggtgtgattatcg |
46326198 |
T |
 |
| Q |
116 |
gaagaaattgacaaacgatatttggttggtgatgacaaaaataaatgattcatagtggaattaatacggcatttgtgataactactaattaggccacgtt |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46326199 |
gaagaaattgacaaacgataattggttggtgctgacaaaaataaatgattcatagtgg----aatacggcatttgtgataactactaattaggccacgtt |
46326294 |
T |
 |
| Q |
216 |
tatatttgttcatttttc |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46326295 |
tatatttgttcatttttc |
46326312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University