View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10611_low_32 (Length: 244)
Name: NF10611_low_32
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10611_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 17245234 - 17245385
Alignment:
| Q |
1 |
tgtgtgtccggttacttctgttgttccactggaaatgatactcataatcaccttgagttttatcgtcacggttaaatattagggattttgtttttgaatc |
100 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17245234 |
tgtgtgtccgattacttcaattgttc-actggaaatgatactcataatcaccttgagttttattgtcacggttaaatattagggattttgttttcgaatc |
17245332 |
T |
|
| Q |
101 |
tgggttatatgaagattgcagttcatgaagttgattcataattgttttcgaat |
153 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17245333 |
tgggttatatgaagattgcagttcatgatgttgattcataattgttttcgaat |
17245385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 37236822 - 37236914
Alignment:
| Q |
1 |
tgtgtgtccggttacttctgttgttccactggaaatgatactcataatcaccttgagttttatcgtcacggttaaatattagggattttgtttt |
94 |
Q |
| |
|
|||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
37236822 |
tgtgtgtccggttacttcaattgttc-accggaaatgatactcataatcaccttgagttttattgtcatggttaaatattagggattttgtttt |
37236914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 99
Target Start/End: Original strand, 34486574 - 34486607
Alignment:
| Q |
66 |
tcacggttaaatattagggattttgtttttgaat |
99 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
34486574 |
tcacggttaaatattaggggttttgtttttgaat |
34486607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University