View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10611_low_33 (Length: 241)
Name: NF10611_low_33
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10611_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 57 - 223
Target Start/End: Complemental strand, 40802051 - 40801886
Alignment:
| Q |
57 |
tttagatctcgagagagtaattttttcaacttagatctaactctctccaccattgttgcacgtacca-tat-atacagctgttatagagaatccaagtcc |
154 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
40802051 |
tttagatcttgagagagtaattttctcaacttagatctaactctctccacc-ttgttgcacgtaccaataccatacagctgttatagagaatccaagtcc |
40801953 |
T |
 |
| Q |
155 |
attatattgatgttaaaaatgagagagagatcgataagttatatatattagagcaaagccagtgatctt |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40801952 |
attatattgatgttaaaaatgaga--gagatcgataagttatatatattagagcaaagctagtgatctt |
40801886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University