View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10611_low_43 (Length: 225)

Name: NF10611_low_43
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10611_low_43
NF10611_low_43
[»] chr3 (1 HSPs)
chr3 (15-54)||(39484095-39484134)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 15 - 54
Target Start/End: Original strand, 39484095 - 39484134
Alignment:
15 agaaaccaaatggggaaattctgtagaaaacaacgacatt 54  Q
    ||||||||||||||||||||||||||||||||||||||||    
39484095 agaaaccaaatggggaaattctgtagaaaacaacgacatt 39484134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University