View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10611_low_46 (Length: 215)

Name: NF10611_low_46
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10611_low_46
NF10611_low_46
[»] chr2 (1 HSPs)
chr2 (19-204)||(19395884-19396069)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 19396069 - 19395884
Alignment:
19 ggtttcccggaaggagaattgaagaaaaagatggagatgatatttgctgaatcaaggcaacttctgagcaactccctcgctgttgtttcacaggtttctc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19396069 ggtttcccggaaggagaattgaagaaaaagatggagatgatatttgctgaatcaaggcaacttctgagcaactccctcgctgttgtttcacaggtttctc 19395970  T
119 aaattgttaatgcatttcaaggtggactttcaggattcaaattaccttggggtaaaacagatgcacatgctcccactccctatgct 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||    
19395969 aaattgttaatgcatttcaaggtggactttcaggattcaaattaccttggggtaaatcagatgcacatgctcccgctcccgatgct 19395884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University