View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10612_low_10 (Length: 274)
Name: NF10612_low_10
Description: NF10612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10612_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 151 - 259
Target Start/End: Original strand, 4877690 - 4877798
Alignment:
| Q |
151 |
gattacatgctttctagtttgttaaataaggcaaatatgtccttcaaattaacagatacctatgtttcttcttttatgctttttgattaagcttttgatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4877690 |
gattacatgctttctagtttgttaaataaggcaaatatgtccttcaaattaacagatacctatgtttcttcttttatgctttttgattaagcttttgatt |
4877789 |
T |
|
| Q |
251 |
atgcctatg |
259 |
Q |
| |
|
||||||||| |
|
|
| T |
4877790 |
atgcctatg |
4877798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 4877588 - 4877702
Alignment:
| Q |
1 |
ataccataacttgctgagcaactttgcacgctctctccataagctatggaaataaggatcggaacttgtttgttcgcgga-ttgattgctagaggtctat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4877588 |
ataccataacttgctgagcaactttgcacgctctctccataagctatggaaataaggatcggaacttgtttgttcgcggatttgattgctagaggtctat |
4877687 |
T |
|
| Q |
100 |
tagattacatgcttt |
114 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4877688 |
tagattacatgcttt |
4877702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 88 - 138
Target Start/End: Complemental strand, 670484 - 670434
Alignment:
| Q |
88 |
ctagaggtctattagattacatgctttttggtttgctaattaaagaactat |
138 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
670484 |
ctagaggtctattagattacatgctttccagttttctaattaaagaactat |
670434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 258
Target Start/End: Complemental strand, 2288395 - 2288345
Alignment:
| Q |
206 |
atacctatgtttcttcttttatgctttttgattaagcttttgattatgcctat |
258 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2288395 |
atacctatgtttcttgatttatgctttttgattaagc--ttgattatgcctat |
2288345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 28326870 - 28326916
Alignment:
| Q |
99 |
ttagattacatgctttttg-gtttgctaattaaagaactatgctttt |
144 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
28326870 |
ttagattacatgcttttttagtttgctaattaaaggactatgctttt |
28326916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 66 - 144
Target Start/End: Complemental strand, 47923090 - 47923009
Alignment:
| Q |
66 |
ttgtttgttcgcggattgattgctagaggtctatta---gattacatgctttttggtttgctaattaaagaactatgctttt |
144 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||| ||||| |||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
47923090 |
ttgttcgttcgtgggttgattgctagaggtctattatcagattatatgcttattggtttgctaatcaaagaactatgatttt |
47923009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 9066862 - 9066898
Alignment:
| Q |
108 |
atgctttttggtttgctaattaaagaactatgctttt |
144 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
9066862 |
atgctttttggtttgctaattgaaggactatgctttt |
9066898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University