View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10612_low_13 (Length: 248)
Name: NF10612_low_13
Description: NF10612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10612_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 49446225 - 49446464
Alignment:
| Q |
1 |
agaatgctaataggcaatttaggaccaccaccaaacatagtatccacaaggagatcaatggtctcaactccgctttgtacaacatggttgacccatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446225 |
agaatgctaataggcaatttaggaccaccaccaaacatagtatccacaaggagatcaatggtctcaactccgctttgtacaacatggttgacccatttga |
49446324 |
T |
|
| Q |
101 |
cgacatggggaaagccaatgatgccctcctcaccatatgtaatgccaaggcaaaaacttttgatggaattacgtgaaagcaaaacagaatacacagacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446325 |
cgacatggggaaagccaatgatgccctcctcaccatatgtaatgccaaggcaaaaacttttgatggaattacgtgaaagcaaaacagaatacacagactc |
49446424 |
T |
|
| Q |
201 |
gctgaagcgaaaacaggcttcttggtgatatagctctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446425 |
gctgaagcgaaaacaggcttcttggtgatatagctctgtg |
49446464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University