View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10612_low_14 (Length: 242)
Name: NF10612_low_14
Description: NF10612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10612_low_14 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 5932067 - 5932293
Alignment:
| Q |
19 |
atgttgtcatgtcaactctcccaacatgttggtcagtttgattgactttaaaacaaaaaattgtacgtaataattctcacaaaaataaagagaattgaaa |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5932067 |
atgttctcatgtcaactctcccaacatgttggtcagtttgattgactttaaaacaaaaaattgtacgtaataattctcacaaaaataaagagaattgaaa |
5932166 |
T |
|
| Q |
119 |
taatatctatcaataatcaatatt---caccacccactttgtgttgtgcaattattattttttccttcatttggttttttagttgcacttttgtaagatt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5932167 |
taatatctatcaataatcaatattcaccaccacccactttgtgttgtgcaattattattttttccttcatttggtttttttgttgcacttttgtaagatt |
5932266 |
T |
|
| Q |
216 |
ctttgaactcaaccaacaaaatctatt |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5932267 |
ctttgaactcaaccaacaaaatctatt |
5932293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University