View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10612_low_16 (Length: 221)
Name: NF10612_low_16
Description: NF10612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10612_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 13858965 - 13858778
Alignment:
| Q |
16 |
agaaacagacattacactcaagaaaagtatatcctaatccaaaagtttgtatttgttatactataaattaaccttggttaggcaaggcttagagcaaatt |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13858965 |
agaaacaaacattacactcaagaaaagtatatcctaatccaaaagtttgtatttgttatactataaattaaccttggttaggcaaggcttagagcaaatt |
13858866 |
T |
|
| Q |
116 |
aaatataccttggatagtatacaacaggcaacagagttcgattagcagcaacaacaagcgcatcaatgggcatattattagtagaaag |
203 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13858865 |
aaatataccctggatagtatacaacaggcaacagagttcgattagcagcaacaacaagcgcatcaatgggcatattattagcagaaag |
13858778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University