View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10612_low_5 (Length: 405)
Name: NF10612_low_5
Description: NF10612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10612_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 205 - 388
Target Start/End: Complemental strand, 50651615 - 50651431
Alignment:
| Q |
205 |
gtgatcccaagggtagcagctcaagcaaagcagtttgattcaatggtgtcgtactaccagcatttttct-ctctcatcataatgagttggtattggaata |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
50651615 |
gtgatcccaagggtagcagctcaagcaaagcagtttgattcaatggtgtcgtcctaccagcattttttttctctcatcataatgagttggtattggaata |
50651516 |
T |
 |
| Q |
304 |
tgtattagggacgagatgatttgtttgtcggagtgaacactctatggttggaacctttgatgtcagtccgaatgggagaagcaaa |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651515 |
tgtattagggacgagatgatttgtttgtcggagtgaacactctatggctggaacctttgatgtcagtccgaatgggagaagcaaa |
50651431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 50651765 - 50651615
Alignment:
| Q |
15 |
acctgtgctttaggaagtgtgtttcaagttttggagcaactgccgtggcatattttctgtcacgatgtggagcttgtggaagagtaggaacctgacaatt |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651765 |
acctgtggtttaggaagtgtgtttcaagttttggagcaactgccgtggcatatttgctgtcacgatgtggagcttgtggaagagtaggaacctgacaatt |
50651666 |
T |
 |
| Q |
115 |
tgggaaaataaagtcgaaagttcagctgatgtggtttgtagaggtcgagcg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651665 |
tgggaaaataaagtcgaaagttcagctgatgtggtttgtagaggtcgagcg |
50651615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University