View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10613_high_1 (Length: 255)
Name: NF10613_high_1
Description: NF10613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10613_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 35787026 - 35786784
Alignment:
| Q |
1 |
ttttggtttgatggtctcattatgaaaaccctacctcttttctgacaaaaggcttagagcttgtgatttgttttaaggatatgaaatgttgtcatttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787026 |
ttttggtttgatggtctcattatgaaaaccctacctcttttctgacaaaaggcttagagcttgtgatttgttttaaggatatgaaatgttgtcatttctt |
35786927 |
T |
|
| Q |
101 |
tggttagtgttttgcatgttcatcaggttggttggtccctacgtcaatcaattattgaaatgtacagggttgatagataactatgtttctgtttgtgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786926 |
tggttagtgttttgcatgttcatcaggttggttggtccctacgtcaatcaattattgaaatgtacagggttgatagataactatgtttctgtttgtgttg |
35786827 |
T |
|
| Q |
201 |
gatcttctgccaattatgttctgtaatcacttttgtctctgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35786826 |
gatcttctgccaattatgttctgtaatcacttttgtctgtgct |
35786784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 107 - 236
Target Start/End: Complemental strand, 35761992 - 35761863
Alignment:
| Q |
107 |
gtgttttgcatgttcatcaggttggttggtccctacgtcaatcaattattgaaatgtacagggttgatagataactatgtttctgtttgtgttggatctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35761992 |
gtgttttgcatgttcatcaggttggttggtccctacgtcatttaattattgaaatgtataggtttgatagataactatgtttctgtttgtgttggatctt |
35761893 |
T |
|
| Q |
207 |
ctgccaattatgttctgtaatcacttttgt |
236 |
Q |
| |
|
||| ||||||||||||| |||||||||| |
|
|
| T |
35761892 |
atgcagattatgttctgtattcacttttgt |
35761863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 169 - 238
Target Start/End: Complemental strand, 35800112 - 35800043
Alignment:
| Q |
169 |
gttgatagataactatgtttctgtttgtgttggatcttctgccaattatgttctgtaatcacttttgtct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | |||||||| |
|
|
| T |
35800112 |
gttgatagataactatgtttctgtttgtgttggatattctgctgattatgttctgtaataatttttgtct |
35800043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 35762244 - 35762187
Alignment:
| Q |
1 |
ttttggtttgatggtctcattatgaaaaccctacctcttttctgacaaaaggcttaga |
58 |
Q |
| |
|
||||||||||||||||||| |||||||| | | |||||||| ||| || ||||||||| |
|
|
| T |
35762244 |
ttttggtttgatggtctcaatatgaaaagcatgcctcttttgtgagaagaggcttaga |
35762187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University