View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10613_high_3 (Length: 240)
Name: NF10613_high_3
Description: NF10613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10613_high_3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 36413338 - 36413560
Alignment:
| Q |
18 |
cctatcatctcttgagatccagctcagatcaaaaattatgttcaaagagttgccagacactaaatatttatgcatctgttttctagaaaaattgttcgcc |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
36413338 |
cctatcatctcttgagattcagctcagatcaagaattatgttcaatgagttgtcagacactaaatatttatgcatctgttttctagaagaattgttcgtc |
36413437 |
T |
|
| Q |
118 |
ttattgtagagactaacttattttgctagactctatcatcatttgttattgatcactatagttagactagtgttggttgatttgatgttttcaaaaaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36413438 |
ttattgtagagactaacttattttgctagactctatcatcatttgttattgatcactatagttagactagtgttggttgatttgatgttttcaaaaaatt |
36413537 |
T |
|
| Q |
218 |
gttgtttaactttgcataattat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36413538 |
gttgtttaactttgcataattat |
36413560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University