View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10613_low_6 (Length: 228)
Name: NF10613_low_6
Description: NF10613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10613_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 36413980 - 36413777
Alignment:
| Q |
1 |
tgatctttttggaccatggcctagtgcaacaaccaatgatccaacgtctaacgtgtcatcaatgcaagatcaaactttgttgcaatttcaacaattgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36413980 |
tgatctttttggaccatggcctagtgcaacaaccaatgatccaacgtctaacgtgtcatcaatgcaagatcaaactttgttgcaatttcaacaactgtgg |
36413881 |
T |
|
| Q |
101 |
ttggaacaacaaaacaagattatagcaaagcatatgacttgaaaaaatgtaaatgtttaagcatttaaattttgtatagtagatgtttaagcattgaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36413880 |
ttggaacaacaaaacaagattatagcaaagcatatgacttgaaaaaatgtaaatgtttaagcatttaaattttgtatagtagatgtttaagcattgaaat |
36413781 |
T |
|
| Q |
201 |
aaac |
204 |
Q |
| |
|
|||| |
|
|
| T |
36413780 |
aaac |
36413777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University