View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10614_low_5 (Length: 277)
Name: NF10614_low_5
Description: NF10614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10614_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 23382737 - 23382487
Alignment:
| Q |
19 |
tgcaaaacacccaaaagttttggtatgtgatgtttatccttcattacttaaagtatatgctattcaacctcattagacccataatgcttatataa--aat |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||| |
|
|
| T |
23382737 |
tgcaaaacacccaaaagttttggtatgaaatgtttatccttcattacttaaagtatatgctattcaacctcattagatccatgatgcttatataattaat |
23382638 |
T |
 |
| Q |
117 |
ttctatttcaggtggttcagattgaaagaagaatttcagctgtcaccggcttcgttcacagctttcttctgcgattaacattcgatcttgctctccaaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23382637 |
ttctatttcaggtggttcagattgaaagaagaatttcagctgtcaccggcttcgttcacagccttcttctgcgattaacattcgatcttgctctccaaag |
23382538 |
T |
 |
| Q |
217 |
tgttgagtgatcatggacaaaggtcctttgttagcatcatcacagcctttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23382537 |
tgttgagtgatcatggacaaaggtcctttgttagcatcatcacagcctttg |
23382487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University