View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10614_low_6 (Length: 253)
Name: NF10614_low_6
Description: NF10614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10614_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 66 - 231
Target Start/End: Original strand, 5312689 - 5312854
Alignment:
| Q |
66 |
tggcttcaatgccgaactgaactagtaatttacaaattcaaaaaatgtgcatcttgttcaaaatcaaaacactaaacactaaattccttacaatttccat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5312689 |
tggcttcaatgccgaactgaactagtaatttacaaattcaaaaaatgtgcatcttgttcaaaatcaaaacactaaacactaaattccttacaatttccat |
5312788 |
T |
 |
| Q |
166 |
ccattgtttagattcaccgcaagagtgactgctagttccgtataagaatttcaccgaatcttgttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5312789 |
ccattgtttagattcaccgcaagagtgactgctagttccatataagaatttcaccgaatcttgttc |
5312854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University