View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10615_high_4 (Length: 250)
Name: NF10615_high_4
Description: NF10615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10615_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 145 - 242
Target Start/End: Complemental strand, 41823098 - 41822999
Alignment:
| Q |
145 |
gacagtttgaattgcatgacttgtgatttatgtattgtgttctctagtttttatttg--gtgattttgatctttcactataattacctatcacctatgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41823098 |
gacagtttgaattgcatgacttgtgatttatgtattgtgttctctagtttttatttggtgtgattttgatctttcactataattacctatctcctatgct |
41822999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 41823242 - 41823162
Alignment:
| Q |
1 |
cttattcttatatcaattaatttgcaaaaatagaatatgcttaatttactatttgatgtttattgttatgatcaacgagtc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41823242 |
cttattcttatatcaattaatttgcaaaaatagaatatgcttaatttactatttgatgtttattgttatgatcaatgagtc |
41823162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University