View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10615_high_8 (Length: 217)
Name: NF10615_high_8
Description: NF10615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10615_high_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 87 - 217
Target Start/End: Complemental strand, 47162803 - 47162673
Alignment:
| Q |
87 |
ctcagtgtaaccaaaaagaaaacaaaagagactttaacttgaatttgagcttaaaataggcataaaaggaaaggggaacgaaaacagtttttcttgaaga |
186 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162803 |
ctcaatgtaaccaaaaagaaaacaaaagagacttaaacttgaatttgagcttaaaataggcataaaaggaaaggggaacgaaaacagtttttcttgaaga |
47162704 |
T |
 |
| Q |
187 |
gtcatgggagaagaacacaagacatagagat |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
47162703 |
gtcatgggagaagaacaaaagacatagagat |
47162673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University