View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10615_low_11 (Length: 242)
Name: NF10615_low_11
Description: NF10615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10615_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 41823262 - 41823486
Alignment:
| Q |
1 |
acaaccctagcatattttgggaatgaagggacatcaaaatgaactacttcagctggatactccccagaaacacaatattcaacataagctataatagaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41823262 |
acaaccctagcatattttgggaatgaagggacatcaaaatgaactacttcagctggatactccccagaaacacaatattcaacataagctataatagaac |
41823361 |
T |
|
| Q |
101 |
tcccatatgaacccacatcaaagtaatctttgctcttcaagagttgtgtaatttgtccaattacataaagaactcctacattactcccaaaataatgcaa |
200 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41823362 |
tcccatttgaacgcacatcaaagtaatctttgctcttcaagagttgtgtaatttgtccaatcacataaagaactcctacattactcccaaaataatgcaa |
41823461 |
T |
|
| Q |
201 |
acaacgtttgtataggaatacttgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41823462 |
acaacgtttgtataggaatacttgt |
41823486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University