View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10616_high_16 (Length: 238)
Name: NF10616_high_16
Description: NF10616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10616_high_16 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 26578059 - 26578201
Alignment:
| Q |
96 |
actaccactatgtaatggccagctagatagatgggtcccacatccctattccttttcttcaattaattcctccagacaatagccttggggcttgagttca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26578059 |
actaccactatgtaatggccagctagatagatggatcccacatccctattccttttcttcaattaattcctccagacaatagccttggggcttgagttca |
26578158 |
T |
 |
| Q |
196 |
cgaaacccagtatactattaattcattgccagaccatagcctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26578159 |
cgaaacccagtatactattaattcattgccagaccatagcctc |
26578201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 26577929 - 26578009
Alignment:
| Q |
16 |
aaaagattgtgggattgtggagtgttcaaaacagtgtgttcgtgtgtacagtgaaatcaaatgtcaacttgtgatccatca |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26577929 |
aaaagagtgtgggattgtggagtgttcaaaacagtgtgttcgtgtgtacagtgaaatcaaatgtcaacttgtgatccatca |
26578009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University