View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10616_high_17 (Length: 230)
Name: NF10616_high_17
Description: NF10616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10616_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 33718719 - 33718921
Alignment:
| Q |
18 |
cgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcatctccggctccacctcaaccgcaaactcattaccggaatttcatctcccggattcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718719 |
cgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcgtctccggctccacctcaaccgcaaactcattaccggaatttcatctcccggattcc |
33718818 |
T |
 |
| Q |
118 |
accatcggaagcagcagcagcatggagcgaattccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718819 |
accatcggaagcagcagcagcatggagcgaattccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttct |
33718918 |
T |
 |
| Q |
218 |
ctc |
220 |
Q |
| |
|
||| |
|
|
| T |
33718919 |
ctc |
33718921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 33720864 - 33720921
Alignment:
| Q |
159 |
gaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc |
216 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33720864 |
gaacatagaaacctgtcgggaatgcaacatagcaggatgtttaggatgcaatttcttc |
33720921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 33735540 - 33735584
Alignment:
| Q |
172 |
tgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735540 |
tgccgggaatgcaacatagcaggatgtttaggatgcaatttcttc |
33735584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 216
Target Start/End: Original strand, 33750323 - 33750390
Alignment:
| Q |
149 |
ttccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc |
216 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
33750323 |
ttccacctgcgaacatagaaacctgccaggaatgcaacattgcaggatgcttaggatgcgatttcttc |
33750390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University