View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10616_high_17 (Length: 230)

Name: NF10616_high_17
Description: NF10616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10616_high_17
NF10616_high_17
[»] chr4 (4 HSPs)
chr4 (18-220)||(33718719-33718921)
chr4 (159-216)||(33720864-33720921)
chr4 (172-216)||(33735540-33735584)
chr4 (149-216)||(33750323-33750390)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 33718719 - 33718921
Alignment:
18 cgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcatctccggctccacctcaaccgcaaactcattaccggaatttcatctcccggattcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33718719 cgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcgtctccggctccacctcaaccgcaaactcattaccggaatttcatctcccggattcc 33718818  T
118 accatcggaagcagcagcagcatggagcgaattccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttct 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33718819 accatcggaagcagcagcagcatggagcgaattccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttct 33718918  T
218 ctc 220  Q
    |||    
33718919 ctc 33718921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 33720864 - 33720921
Alignment:
159 gaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc 216  Q
    |||||| |||||||| || |||||||||||||||||||||||||||||||||||||||    
33720864 gaacatagaaacctgtcgggaatgcaacatagcaggatgtttaggatgcaatttcttc 33720921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 33735540 - 33735584
Alignment:
172 tgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc 216  Q
    ||||| |||||||||||||||||||||||||||||||||||||||    
33735540 tgccgggaatgcaacatagcaggatgtttaggatgcaatttcttc 33735584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 216
Target Start/End: Original strand, 33750323 - 33750390
Alignment:
149 ttccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc 216  Q
    |||||||  ||||||| ||||||||||  ||||||||||| |||||||| ||||||||| ||||||||    
33750323 ttccacctgcgaacatagaaacctgccaggaatgcaacattgcaggatgcttaggatgcgatttcttc 33750390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University