View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10616_low_10 (Length: 322)
Name: NF10616_low_10
Description: NF10616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10616_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 37160614 - 37160831
Alignment:
| Q |
17 |
aattgtttacctcatttttctctttgactaacctaaaattaaatccttgtagagctatgatcccacaacacactttgaaaccacagtgaaagatgtggtt |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160614 |
aattgtttaccttatttttctctttgactaacctaaaattaaatccttgtagagctatgatcccacaacacactttgaaaccacagtgaaagatgtggtt |
37160713 |
T |
|
| Q |
117 |
cagatgtacagtaagatcactggaaaggtatgtagttgaattcattatatgtctagttgaaacactttcaaatatactttggtttagaaaatgatagact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160714 |
cagatgtacagtaagatcactggaaaggtatgtagttgaactcattatatgtctagttgaaacactttcaaatatactttggtttagaaaatgatagact |
37160813 |
T |
|
| Q |
217 |
tctaaaacaagactagtg |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37160814 |
tctaaaacaagactagtg |
37160831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University