View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10616_low_12 (Length: 300)
Name: NF10616_low_12
Description: NF10616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10616_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 17 - 178
Target Start/End: Complemental strand, 48585501 - 48585343
Alignment:
| Q |
17 |
acatcagggatgcatcaatttgatgttnnnnnnnntgctttcttgaattgatatttagatgtagtgcatatggagattccagtgcatatgacccacaaat |
116 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
48585501 |
acatcagggatgcaccaatttgatgttaaaaaaaatgctttcttgaattgatatttagatgtagtgtatatggagattccagtgcaaa---cccacaaat |
48585405 |
T |
 |
| Q |
117 |
ggagagaatgaggtgtgcagattaaaggggtttaacaacagttctcttttgttgacattttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
48585404 |
ggagagaatgaggtgtgcagattaaaggtgtttaacaacagttctcttttgttggcattttt |
48585343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University