View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10616_low_19 (Length: 243)
Name: NF10616_low_19
Description: NF10616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10616_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 26954980 - 26954766
Alignment:
| Q |
19 |
gatgcaataatggctaatgctttgtacttagccttggtggatgaccttgctactgctctt-----cgatgatttccacaagatgaggttggaactctagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954980 |
gatgcaataatggctaatgctttgtacttagccttggtggatgaccttgctactgctctttgcttcgatgatttccacaagatgaggttggaactctagt |
26954881 |
T |
 |
| Q |
114 |
agacaatgtgagcagatgtgtagtcatctttattatcagtccaatcagtatccttatatgcaatgagtgtagaagaattctgtttccgaagaaaaaggcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954880 |
agacaatgtgagcagatgtgtagtcatctttattatcagtccaatcagtatccttatatgcaatgagtgtagaagaattctgtttccgaagaaaaaggcc |
26954781 |
T |
 |
| Q |
214 |
atgaaaattgtacct |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26954780 |
atgaaaattgtacct |
26954766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University