View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10617_high_8 (Length: 225)
Name: NF10617_high_8
Description: NF10617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10617_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 7144209 - 7144401
Alignment:
| Q |
13 |
agatgaaccacatgagggatggctaaattccaaaggcaggttatgatctatttccgaatatgattgttagttgtgacatgagagacaatagaacatgaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144209 |
agatgaaccacatgagggatggctaaattccaaaggcaggttatgatctatttccgaatatgattgttagttgtgacatgagagacaatagaacatgaaa |
7144308 |
T |
 |
| Q |
113 |
aatatgggtgacttgtgacnnnnnnnnnnnataagatttattgaaatgattactcaaaacaatacattgaaaggaagtattggatttagccacc |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144309 |
aatatgggtgacttgtgac-ttttttttttataagatttattgaaatgagtactcaaaacaatacattgaaaggaagtattggatttagccacc |
7144401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University