View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10617_low_13 (Length: 236)
Name: NF10617_low_13
Description: NF10617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10617_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 62 - 225
Target Start/End: Complemental strand, 39276301 - 39276137
Alignment:
| Q |
62 |
caacttatgagacatcaattaaatagtgcggtaatttattataggaggatgttattgattattttgacaataattaagaatttaactattgtatttcaat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276301 |
caacttatgagacatcaattaaatagtgcggtaatttattataggaggatgttattgattattttgacaataattaagaatttaactattgtatttcaat |
39276202 |
T |
|
| Q |
162 |
tatttgttatttgtggattcctcaccatcaaacatagtcgctatcattttctctt-atctttctt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39276201 |
tatttgttatttgtggattcctcaccatcaaacatagtcgctatcattttctcttgatctttctt |
39276137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 39276537 - 39276496
Alignment:
| Q |
16 |
acgactctcatttaaattaccatgtttttcgtctaattttct |
57 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
39276537 |
acgactctcatttaaattacgatgtttttcgtcaaattttct |
39276496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University