View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10617_low_14 (Length: 227)
Name: NF10617_low_14
Description: NF10617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10617_low_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 11228924 - 11229145
Alignment:
| Q |
1 |
atttaacaatatgatattcctcccaaatatcatttgtaagtatactctcttcaaaactgaacaataaaaatttactcttgagcaaatgtttggtatcaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11228924 |
atttaacaatatgatattcctcccaaatatcatttgtaagtatactctcttcaaaactgaacaataaaa-----ctcttgagcaaatgtttggtatcaca |
11229018 |
T |
|
| Q |
101 |
ttgaaacaccataaacacgtagagatccaaacccatcaagatatttagaagttgggatattgatgaaatgtccaaagtgcaggagtttgtttaggagtcc |
200 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11229019 |
ttgaaacaccatacacacatagagatccaaacccatcaagatatttagaagtcgggatattgatgaaatgtccaaagtgcaggagtttgtttaggagtcc |
11229118 |
T |
|
| Q |
201 |
tacaatggtctcagatcaatccgcaaa |
227 |
Q |
| |
|
|| ||||||| ||||| |||||||||| |
|
|
| T |
11229119 |
tataatggtcccagataaatccgcaaa |
11229145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University