View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10617_low_15 (Length: 225)

Name: NF10617_low_15
Description: NF10617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10617_low_15
NF10617_low_15
[»] chr3 (1 HSPs)
chr3 (13-206)||(7144209-7144401)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 7144209 - 7144401
Alignment:
13 agatgaaccacatgagggatggctaaattccaaaggcaggttatgatctatttccgaatatgattgttagttgtgacatgagagacaatagaacatgaaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7144209 agatgaaccacatgagggatggctaaattccaaaggcaggttatgatctatttccgaatatgattgttagttgtgacatgagagacaatagaacatgaaa 7144308  T
113 aatatgggtgacttgtgacnnnnnnnnnnnataagatttattgaaatgattactcaaaacaatacattgaaaggaagtattggatttagccacc 206  Q
    |||||||||||||||||||           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
7144309 aatatgggtgacttgtgac-ttttttttttataagatttattgaaatgagtactcaaaacaatacattgaaaggaagtattggatttagccacc 7144401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University