View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10618_high_2 (Length: 372)
Name: NF10618_high_2
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10618_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 33 - 355
Target Start/End: Original strand, 43366671 - 43366993
Alignment:
| Q |
33 |
aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgatgagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366671 |
aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgatgagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaa |
43366770 |
T |
|
| Q |
133 |
gttacacacagcagcagaatggaatgaggaatgtaattgaagtagaaggatgaagagcatttacaataaaaggggaaggagcgaagagagagagcatgat |
232 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366771 |
gttacacacagcagcaaaatggaatgaggaatgtaattgaagtagaaggatgaagagcatttacaataaaaggggaaggagcgaagagagagagcatgat |
43366870 |
T |
|
| Q |
233 |
gaaaagaaggagaaggcagacggagatggcggaaatgaggaggcggtgaatgagacgacggcggaggaaactggcaagaaggagtccgatgagtcttctg |
332 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43366871 |
gaaaagaaagagaaggcagacggagatggaggaaatgaggaggcgatgaatgagacgacggcggaggaaactggaaagaaggagtccgatgagtcttctg |
43366970 |
T |
|
| Q |
333 |
gacttgtctgtcttctttctctt |
355 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43366971 |
gacttgtctgtcttctttctctt |
43366993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University