View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10618_low_10 (Length: 285)
Name: NF10618_low_10
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10618_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 135 - 272
Target Start/End: Original strand, 42328636 - 42328772
Alignment:
| Q |
135 |
tagaataataacaatcgttatccttctttnnnnnnnnncaattgttatcctaaataatgaacggttaacttgaaagnnnnnnngttaatagacaataata |
234 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42328636 |
tagattaataacaatcgttatccttctttaaaaaaaa-caattgttatcctaaataatgaacggttaacttgaaagaaaaaaagttaatagacaataata |
42328734 |
T |
|
| Q |
235 |
ttatactgtttattgctcttttatttatgattatgtct |
272 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42328735 |
ttatactgtttgttgctcttttatttatgattatgtct |
42328772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University