View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10618_low_10 (Length: 285)

Name: NF10618_low_10
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10618_low_10
NF10618_low_10
[»] chr1 (1 HSPs)
chr1 (135-272)||(42328636-42328772)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 135 - 272
Target Start/End: Original strand, 42328636 - 42328772
Alignment:
135 tagaataataacaatcgttatccttctttnnnnnnnnncaattgttatcctaaataatgaacggttaacttgaaagnnnnnnngttaatagacaataata 234  Q
    |||| ||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||       |||||||||||||||||    
42328636 tagattaataacaatcgttatccttctttaaaaaaaa-caattgttatcctaaataatgaacggttaacttgaaagaaaaaaagttaatagacaataata 42328734  T
235 ttatactgtttattgctcttttatttatgattatgtct 272  Q
    ||||||||||| ||||||||||||||||||||||||||    
42328735 ttatactgtttgttgctcttttatttatgattatgtct 42328772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University