View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10618_low_11 (Length: 281)
Name: NF10618_low_11
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10618_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 39411772 - 39411508
Alignment:
| Q |
1 |
gaccattccatctttctctctttcaaagcaaacaggcttgcgtgaagaagaaactgattttgaagatgaaggatatgatgatgatttcagtagtgtgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39411772 |
gaccattccatctttctctctttcaaagcaaacaggcttgcgtgaagaagaaactgattttgaagatgaaggatatgatgatgatttcagtagtgtgctg |
39411673 |
T |
|
| Q |
101 |
aatagtactgccagtggtgtggtggtgaatgatgaagtgaaggatagcgttttcagggtgagttttggtgaggagggaaaggttggtaataaagaaatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39411672 |
aatagtactgccagtggtgtggtggtgaatgatgaagtgaaggatagagttttcagggtgagttttggtgaggagggaaaggttggtaataaagaaatgt |
39411573 |
T |
|
| Q |
201 |
atcttgctaagggacttggtgttgatggtataggtggctgcagaggagggaatggaggtggtgat |
265 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39411572 |
atcttgcaaagggacttggtgttgatggtataggtggctgcagtggagggaatggaggtggtgat |
39411508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 39790133 - 39790217
Alignment:
| Q |
142 |
ggatagcgttttcagggtgagttttggtgaggagggaaaggttggtaataaagaaatgtatcttgctaagggacttggtgttgat |
226 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||| || ||||| |||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
39790133 |
ggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataatgagatgtatcttgcaaagggacttggtgttgat |
39790217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 39789995 - 39790045
Alignment:
| Q |
1 |
gaccattccatctttctctctttcaaagcaaacaggcttgcgtgaagaaga |
51 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
39789995 |
gaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaaga |
39790045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University