View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10618_low_18 (Length: 236)
Name: NF10618_low_18
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10618_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 76 - 218
Target Start/End: Original strand, 22080890 - 22081032
Alignment:
| Q |
76 |
tcttgaagtgtgtttggaaggttaataagtttaaggagtagaccttctctgcagaagtacaacccacttcccccaaggaagtgacatatgctttttcaaa |
175 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22080890 |
tcttgaagtgtgtttgcaaggttaataagtttaggcagtagaccttctctgcagaagtacaacccacttcccccaaggaagtgacatatgctttttcaaa |
22080989 |
T |
|
| Q |
176 |
aaccttttgaaaatctttctgcagatttccctcatttccctct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22080990 |
aaccttttgaaaatctttctgcagatttccctcatttccctct |
22081032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 132 - 208
Target Start/End: Complemental strand, 1521913 - 1521837
Alignment:
| Q |
132 |
gtacaacccacttcccccaaggaagtgacatatgctttttcaaaaaccttttgaaaatctttctgcagatttccctc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| || ||| |||||||||||| ||||||||||| |
|
|
| T |
1521913 |
gtacaacccacttcccccaaggaagtgacatatgctttttccaaagccatttcaaaatctttctgaagatttccctc |
1521837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University