View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10618_low_23 (Length: 206)
Name: NF10618_low_23
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10618_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 1539076 - 1538907
Alignment:
| Q |
1 |
tacaaagaggctaagtttgcgggcagtggtgcatagtggtgtgttttatgtgcttggagtcctgttgtatttgatggctgtttttgctgggtgctgtaca |
100 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1539076 |
tacaaagaggctaagtttgtgtgcagtggtgcatagtggtgtgttttatgtgcttggagtcctgttgtatttgatggctgtttttgctgggtgctgtaca |
1538977 |
T |
|
| Q |
101 |
acacgtttggtgtgctgttttctgcgctagttcggtctgttttctggcttgggtgctgtctcagttgctt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1538976 |
acacgtttggtgtgctgttttctgcgctagttcggtctgttttctggcttgggtgctgtctcagttgctt |
1538907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University