View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_high_7 (Length: 228)
Name: NF10619_high_7
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 36730402 - 36730167
Alignment:
| Q |
1 |
aatatcttattgactttttgaatatgattgatccagccattcaaaatatatacctttgagtccttggtcactcatggaaaatatataatttatat----- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36730402 |
aatatcttattgactttttgaatatgattgatctagccattcaaaatatatacctttatgtccttgg-cactcatggaaaatatataatttatatagttg |
36730304 |
T |
 |
| Q |
96 |
----ggtctaaatatgaccatgaccatacttatttcatctttgtcagctttttcttcgagaagcaatgaatatttgaggtcaaattagcaacttcgctac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
36730303 |
aataggtctaaatatgaccatgaccatacttatttcgtctttgtcaactttttcttcgagaagcaatggatatttgaggtgaaattagcaacttcgctac |
36730204 |
T |
 |
| Q |
192 |
ttacagcagccactcatatttctgcaatttttatttt |
228 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36730203 |
ttacagcagccactcatatttctacaatttttatttt |
36730167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University