View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_12 (Length: 275)
Name: NF10619_low_12
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 266
Target Start/End: Original strand, 24709558 - 24709813
Alignment:
| Q |
11 |
cagagagcttagtctcatgaagaatgagannnnnnngtttagttttcttacgtactaggatttgaacgatcacattgtttacctttcccttacgtacttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24709558 |
cagagagcttagtctcatgaagaatgagatttttt-gtttagttttcttacgtactaggatttgaacgatcacattgtttacctttcccttacgtacttg |
24709656 |
T |
|
| Q |
111 |
tatcatgagaaatataagatgcgttggaacctggaatcgtccaaagtaattggtcatgctaatcggttatgcttcctatt-ggtatattgcaacaacacc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24709657 |
tatcatgagaaatataagatgcgttggaacctggaatcgtccaaactaattggccatgctaatcggttatgcttcctattctgtatattgcaacaacacc |
24709756 |
T |
|
| Q |
210 |
atttattgtgaaggccacatttgtaccctctacacttcgttttaattctcatctctg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24709757 |
atttattgtgaaggccacatttgtaccctctacacttcgttttaattctcatctctg |
24709813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 62 - 124
Target Start/End: Complemental strand, 30509679 - 30509617
Alignment:
| Q |
62 |
gtactaggatttgaacgatcacattgtttacctttcccttacgtacttgtatcatgagaaata |
124 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
30509679 |
gtactaggatttgaacggtcacaatgtttacctttgtcttatgtacttgcatcatgagaaata |
30509617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 39
Target Start/End: Complemental strand, 30510010 - 30509982
Alignment:
| Q |
11 |
cagagagcttagtctcatgaagaatgaga |
39 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30510010 |
cagagagcttagtctcatgaagaatgaga |
30509982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University