View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_13 (Length: 272)
Name: NF10619_low_13
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 15733415 - 15733169
Alignment:
| Q |
18 |
gtttaaaaccaaatcatagttctatatggatttagccaattaaaatcgacacctgcgaacatcgaacgtaagattttaagaggaatacacttcaacgtat |
117 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15733415 |
gtttaaaaccaaagcatagctctctatggatttagcccattaaaatcaacacctgcgaacatcgaacgtaagattttaagaggaatacacttcaaggtat |
15733316 |
T |
 |
| Q |
118 |
caagtcaacaccatcgagctatttcaaatgtgttagactattcttgaagtagaggaatacgtgtgaaatatcccaacagaaatcttgttggaaaattact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15733315 |
caagtcaacaccatcgagctatttcaaatgtgttagactattcttgaagtagaggaatacgtgtgaaatatcccaacagaaatcttgttggaaaattact |
15733216 |
T |
 |
| Q |
218 |
gaagatcccccatctctctctc--gttcattccccttctcctctctg |
262 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
15733215 |
gaagatcccccatctctctctcgagttcattcccattctcctttctg |
15733169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University