View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_16 (Length: 254)
Name: NF10619_low_16
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 40787072 - 40787213
Alignment:
| Q |
1 |
attaggattttcatcactaaacatttgtggtgcttcctgcatatgcatcatttgaacttgtccatagttataaccttcatcaaatccnnnnnnnccacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40787072 |
attaggattttcatcactaaacatttgtggtgcttcctgcatatgcatcatttgaacttgtccatagttataaccttcatcaaatccaaaaaaaccacca |
40787171 |
T |
|
| Q |
101 |
tatccataaccattaccataaccataaccgtaactaggttgtgtcaaa |
148 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40787172 |
tatccataaccatt------accataaccgtaactaggttgtgtcaaa |
40787213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University