View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_19 (Length: 244)
Name: NF10619_low_19
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 15178456 - 15178668
Alignment:
| Q |
9 |
ttaaattcaatggtgtacaaatgaagaagtttctttaaagctagaaggaaacagttacacctgcctctacataaattgtcttcactcccttcatttgtgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15178456 |
ttaaattcaatggtgtacaaatgaagaagtctctttaaagctagaaggaaacagttacacctgcctctacataaattgtcttcactcccttcatttgtgt |
15178555 |
T |
 |
| Q |
109 |
gtatgagaaaccaaaaccaaaaccaaaaccttaacattgtaaactaaatttatgtttaccatgagattctcaaccctagcatttctcttatcacttttgg |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15178556 |
gtatgag------aaaccaaaaccaaaaccttaacattctaaactaaatttatgtttaccatgagattctcaaccctagcatttctcttatcacttttgg |
15178649 |
T |
 |
| Q |
209 |
tgatactacaagtacaaga |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15178650 |
tgatactacaagtacaaga |
15178668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University