View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_2 (Length: 396)
Name: NF10619_low_2
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 19 - 383
Target Start/End: Complemental strand, 45841881 - 45841517
Alignment:
| Q |
19 |
aaaaacaccgccggacttcaacgccggccaccagaaacttccaaagatgaaggtggttgcactcgttagcggcgggaaagacaggtgctacgccctgatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45841881 |
aaaaacaccgccggacttcaacgccggccaccagaaacttccaaagatgaaggtggttgcacttgttagcggcgggaaagacagttgctacgccatgatg |
45841782 |
T |
 |
| Q |
119 |
aagtgtatttaatacggccatccgatcgtcgcgttggcgaatctgatgccggttgatgattctgtcgacgaactcgatagctacatgtatcaaactgttg |
218 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45841781 |
aagtgtattcaatacggccatcagatcgtcgcgttggcgaatctgatgccggttgatgattctgtcgacgaactcgatagctacatgtatcaaactgttg |
45841682 |
T |
 |
| Q |
219 |
gacatcaaattatcatcaaatatgctgagtgtatgggattgccattgttcaggaggagaattcaaggttcatcaaagcatcttgagcttggttataaaag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45841681 |
gacatcaaattatcatcaaatatgctgagtgtatgggattgccattatttaggaggagaattcaaggttcatcaaagcatcttgagcttggttataaaag |
45841582 |
T |
 |
| Q |
319 |
gactcaaggtgatgaagttgaagatatgtatattttgttacgcgaagtcaaaaggcagatcccct |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45841581 |
gactcaaggtgatgaagttgaagatatgtatattttgttacgcgaagtcaagaggcagatcccct |
45841517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University