View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_23 (Length: 237)
Name: NF10619_low_23
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 3 - 219
Target Start/End: Complemental strand, 11181028 - 11180803
Alignment:
| Q |
3 |
gcaggtgatagatacagaaacaccnnnnnnnccgagggtgcctttctagtctatactacaaatagctgttcctttgacaacattgttggaaatcttgttt |
102 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181028 |
gcaggtgatagatacagaaacaccaaaaaaaccgagggtgcctttctagtctatactacaaatagctgttcctttgacaacattgttggaaatcttgttt |
11180929 |
T |
 |
| Q |
103 |
caattccaattttgatttttattctctcaactcaaccaccatttgtactt---------cactcactcgtgtaacttgattggaccaaacacttcagttc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11180928 |
caattccaattttgatttttattctctcaactcaaccaccatttgtacttcactgagttcactcactcgtgtaacttgattggaccaaacacttcagttc |
11180829 |
T |
 |
| Q |
194 |
agtaatgtacctctcatctatctcct |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11180828 |
agtaatgtacctctcatctatctcct |
11180803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University