View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10619_low_26 (Length: 225)
Name: NF10619_low_26
Description: NF10619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10619_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 27968515 - 27968327
Alignment:
| Q |
19 |
aacatagaacatagaacaacaattgtgtgtaccttaaaaagtacnnnnnnnncctgagaaagtttctaaaaatataatccaattagaacttaagaaggtt |
118 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27968515 |
aacaaagaacatagaataacaattgtgtgtaccttaaaaagtacaaaaaaa-cctgagaaagtttctaaaaatataatccaattagaacttaagaaggtt |
27968417 |
T |
|
| Q |
119 |
tgaataaagtgaataagatgaagaagagagaatgaaagagagtttgcaatgcaatttgtatacgtattgcagataccgttggattgttat |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27968416 |
tgtataaagtgaataagatgaagaagagagaatgaaagagagtttgcaatgcaatttgtatacgtattgcagataccgttggattgttat |
27968327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University