View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10620_high_7 (Length: 299)
Name: NF10620_high_7
Description: NF10620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10620_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 17 - 152
Target Start/End: Original strand, 44151081 - 44151216
Alignment:
| Q |
17 |
accaactgctccaaacgtcctgtaggcacggatcgttaaagtaggttggataggttagtagacccgattgtggatggattgatacggtcggtcttgggtg |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44151081 |
accacctgctccaaacgtcctgtaggcacggatcgttaaagtgggttggataggttagtagacccgattgtggatggattgatacggtcggttttgggtg |
44151180 |
T |
 |
| Q |
117 |
gataatctgagtccaaccaagaccaccatccgtctg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44151181 |
gataatctgagtccaaccaagaccaccatccgtctg |
44151216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 221 - 295
Target Start/End: Original strand, 44151285 - 44151359
Alignment:
| Q |
221 |
ggtttccaaggcccaaatatactactactactcacaagttatagttattatatctcaccatttttcatctctctc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
44151285 |
ggtttccaaggcccaaatatactactactactcacaagttatagttattatatctcaccattttccatttctctc |
44151359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University