View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10620_high_8 (Length: 271)
Name: NF10620_high_8
Description: NF10620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10620_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 49 - 134
Target Start/End: Original strand, 17088412 - 17088495
Alignment:
| Q |
49 |
ccatatatgactatttttatgtggaaataatggctcaaaggcatgcacttttagtcaatggataactgtgatttccatgatctatg |
134 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17088412 |
ccatatatgaatatttttatgtggaaataatggctcaaag-ca-gcacttttagtcaatggataactgtgatttgcatgatctatg |
17088495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 17088219 - 17088251
Alignment:
| Q |
24 |
acattcatattttggtccacaatgtccatatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17088219 |
acattcatatttttgtccacaatgtccatatat |
17088251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 29269042 - 29268973
Alignment:
| Q |
62 |
tttttatgtggaaataatggctcaaaggcatgcacttttagtcaatggataactgtgatttccatgatct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||| | ||||| ||| ||||||||| |
|
|
| T |
29269042 |
tttttatgtggaaataatggctcaaaggaatgcacttttagtcattggcttactgtaattaccatgatct |
29268973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 93
Target Start/End: Original strand, 5103760 - 5103828
Alignment:
| Q |
26 |
attcatat-tttggtccacaatgtccatatatgactatttttatgtggaaataatggctcaaaggcatg |
93 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||| | | ||||||| |||||||||||||||||||||| |
|
|
| T |
5103760 |
attcatatatttgatccacaagttccatatatgattctatttatgttgaaataatggctcaaaggcatg |
5103828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University