View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10620_low_19 (Length: 240)
Name: NF10620_low_19
Description: NF10620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10620_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 29007117 - 29007336
Alignment:
| Q |
1 |
acatgcatcaggatattgacaatg-tacaattcactgatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgattgcaca--acacaagaaaac |
97 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
29007117 |
acatgcatcaggatattgaaaatgatacaattca--gatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgattgcacagcacacaaaaaaat |
29007214 |
T |
|
| Q |
98 |
gtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattacatttgcatttgaattgtacagggttgatgttatgtgc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007215 |
gtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattgcatttgcatttgaattgtacagggttgatgttatgtgc |
29007314 |
T |
|
| Q |
198 |
agttgtgtcgttgagttcaatt |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29007315 |
agttgtgtcgttgagttcaatt |
29007336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University